PYCR1 (NM_001282280) Human Untagged Clone

CAT#: SC335311

PYCR1 (untagged) - Human pyrroline-5-carboxylate reductase 1 (PYCR1), transcript variant 4



  "NM_001282280" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PYCR1 mouse monoclonal antibody,clone OTI4F2
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARCL2B; ARCL3B; P5C; P5CR; PIG45; PP222; PRO3; PYCR
Vector pCMV6-Entry
Sequence Data
>SC335311 representing NM_001282280.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCGTGGGCTTCATCGGCGCTGGCCAGCTGGCTTTTGCCCTGGCCAAGGGCTTCACAGCAGCAGGC
GTCTTGGCTGCCCACAAGATAATGGCTAGCTCCCCAGACATGGACCTGGCCACAGTTTCTGCTCTCAGG
AAGATGGGGGTGAAGTTGACACCCCACAACAAGGAGACGGTGCAGCACAGTGATGTGCTCTTCCTGGCT
GTGAAGCCACACATCATCCCCTTCATCCTGGATGAAATAGGCGCCGACATTGAGGACAGACACATTGTG
GTGTCCTGCGCGGCCGGCGTCACCATCAGCTCCATTGAGAAGAAGCTGTCAGCGTTTCGGCCAGCCCCC
AGGGTCATCCGCTGCATGACCAACACTCCAGTCGTGGTGCGGGAGGGGGCCACCGTGTATGCCACAGGC
ACGCACGCCCAGGTGGAGGACGGGAGGCTCATGGAGCAGCTGCTGAGCAGCGTGGGCTTCTGCACGGAG
GTGGAAGAGGACCTGATTGATGCCGTCACGGGGCTCAGTGGCAGCGGCCCCGCCTACGCATTCACAGCC
CTGGATGCCCTGGCTGATGGGGGTGTGAAGATGGGACTTCCAAGGCGCCTGGCAGTCCGCCTCGGGGCC
CAGGCCCTCCTGGGGGCTGCCAAGATGCTGCTGCACTCAGAACAGCACCCAGGCCAGCTCAAGGACAAC
GTCAGCTCTCCTGGTGGGGCCACCATCCATGCCTTGCATGTGCTGGAGAGTGGGGGCTTCCGCTCCCTG
CTCATCAACGCTGTGGAGGCCTCCTGCATCCGCACACGGGAGCTGCAGTCCATGGCTGACCAGGAGCAG
GTGTCACCAGCCGCCATCAAGAAGACCATCCTGGACAAGGTGAAGCTGGACTCCCCTGCAGGGACCGCT
CTGTCGCCTTCTGGCCACACCAAGCTGCTCCCCCGCAGCCTGGCCCCAGCGGGCAAGGATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001282280
Insert Size 960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282280.1
RefSeq Size 1904 bp
RefSeq ORF 960 bp
Locus ID 5831
UniProt ID P32322
Protein Pathways Arginine and proline metabolism, Metabolic pathways
MW 33.4 kDa
Gene Summary This gene encodes an enzyme that catalyzes the NAD(P)H-dependent conversion of pyrroline-5-carboxylate to proline. This enzyme may also play a physiologic role in the generation of NADP(+) in some cell types. The protein forms a homopolymer and localizes to the mitochondrion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (4) contains an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 5. The encoded isoform (1) has a distinct N-terminus and is shorter than isoform 5. Variants 1 and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...