MSF (SEPT9) (NM_001293697) Human Untagged Clone

CAT#: SC335418

SEPT9 (untagged) - Human septin 9 (SEPT9), transcript variant 10



  "NM_001293697" in other vectors (2)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SEPT9 mouse monoclonal antibody,clone OTI3G2
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AF17q25; MSF; MSF1; NAPB; PNUTL4; SEPT9; SeptD1; SINT1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335418 representing NM_001293697.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGACACCCCCAGAGATGCCGGGCTCAAGCAGGCGCCTGCATCACGGAACGAGAAGGCCCCGGTG
GACTTCGGCTACGTGGGGATTGACTCCATCCTGGAGCAGATGCGCCGGAAGGCCATGAAGCAGGGCTTC
GAGTTCAACATCATGGTGGTCGGGCAGAGCGGCTTGGGTAAATCCACCTTAATCAACACCCTCTTCAAA
TCCAAAATCAGCCGGAAGTCGGTGCAGCCCACCTCAGAGGAGCGCATCCCCAAGACCATCGAGATCAAG
TCCATCACGCACGATATTGAGGAGAAAGGCGTCCGGATGAAGCTGACAGTGATTGACACACCAGGGTTC
GGGGACCACATCAACAACGAGAACTGCTGGCAGCCCATCATGAAGTTCATCAATGACCAGTACGAGAAA
TACCTGCAGGAGGAGGTCAACATCAACCGCAAGAAGCGCATCCCGGACACCCGCGTCCACTGCTGCCTC
TACTTCATCCCCGCCACCGGCCACTCCCTCAGGCCCCTGGACATCGAGTTTATGAAACGCCTGAGCAAG
GTGGTCAACATCGTCCCTGTCATCGCCAAGGCGGACACACTCACCCTGGAGGAGAGGGTCCACTTCAAA
CAGCGGATCACCGCAGACCTGCTGTCCAACGGCATCGACGTGTACCCCCAGAAGGAATTTGATGAGGAC
TCGGAGGACCGGCTGGTGAACGAGAAGTTCCGGGAGATGATCCCATTTGCTGTGGTGGGCAGTGACCAC
GAGTACCAGGTCAACGGCAAGAGGATCCTTGGGAGGAAGACCAAGTGGGGTACCATCGAAGTTGAAAAC
ACCACACACTGTGAGTTTGCCTACCTGCGGGACCTTCTCATCAGGACGCACATGCAGAACATCAAGGAC
ATCACCAGCAGCATCCACTTCGAGGCGTACCGTGTGAAGCGCCTCAACGAGGGCAGCAGCGCCATGGCC
AACGGCATGGAGGAGAAGGAGCCAGAAGCCCCGGAGATGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001293697
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001293697.1
RefSeq Size 3275 bp
RefSeq ORF 1008 bp
Locus ID 10801
UniProt ID Q9UHD8
Protein Families Druggable Genome
MW 38.5 kDa
Gene Summary This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
Transcript Variant: This variant (10) lacks three 5' exons, but has an alternate 5' exon, which results in a downstream AUG start codon, as compared to variant 1. The resulting isoform (f) has a much shorter N-terminus, as compared to isoform a. Variants 7, 10 and 11 encode the same isoform f.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...