MXRA8 (NM_001282582) Human Untagged Clone

CAT#: SC336154

MXRA8 (untagged) - Human matrix-remodelling associated 8 (MXRA8), transcript variant 5



  "NM_001282582" in other vectors (2)

CNY 4280.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
MXRA8 Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASP3
Vector pCMV6-Entry
Sequence Data
>SC336154 representing NM_001282582.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGCTGCCATCCCGAATCCTGCTTTGGAAACTTGTGCTTCTGCAGAGCTCTGCTGTTCTCCTGCAC
TCAGGGTCCTCGGTACCCGCCGCTGCTGGCAGCTCCGTGGTGTCCGAGTCCGCGGTGAGCTGGGAGGCG
GGCGCCCGGGCGGTGCTGCGCTGCCAGAGCCCGCGCATGGTGTGGACCCAGGACCGGCTGCACGACCGC
CAGCGCGTGCTCCACTGGGACCTGCGCGGCCCCGGGGGTGGCCCCGCGCGGCGCCTGCTGGACTTGTAC
TCGGCGGGCGAGCAGCGCGTGTACGAGGCGCGGGACCGCGGCCGCCTGGAGCTCTCGGCCTCGGCCTTC
GACGACGGCAACTTCTCGCTGCTCATCCGCGCGGTGGAGGAGACGGACGCGGGGCTGTACACCTGCAAC
CTGCACCATCACTACTGCCACCTCTACGAGAGCCTGGCCGTCCGCCTGGAGGTCACCGACGGCCCCCCG
GCCACCCCCGCCTACTGGGACGGCGAGAAGGAGGTGCTGGCGGTGGCGCGCGGCGCACCCGCGCTTCTG
ACCTGCGTGAACCGCGGGCACGTGTGGACCGACCGGCACGTGGAGGAGGCTCAACAGGTGGTGCACTGG
GACCGGCAGCCGCCCGGGGTCCCGCACGACCGCGCGGACCGCCTGCTGGACCTCTACGCGTCGGGCGAG
CGCCGCGCCTACGGGCCCCTTTTTCTGCGCGACCGCGTGGCTGTGGGCGCGGATGCCTTTGAGCGCGGT
GACTTCTCACTGCGTATCGAGCCGCTGGAGGTCGCCGACGAGGGCACCTACTCCTGCCACCTGCACCAC
CATTACTGTGGCCTGCACGAACGCCGCGTCTTCCACCTGACGGTCGCCGAACCCCACGCGGAGCCGCCC
CCCCGGGGCTCTCCGGGCAACGGCTCCAGCCACAGCGGCGCCCCAGGCCCAGACCCCACACTGGCGCGC
GGCCACAACGTCATCAATGTCATCGTCCCCGAGAGCCGAGCCCACTTCTTCCAGCAGCTGGGCTACGTG
CTGGCCACGCTGCTGCTCTTCATCCTGCTACTGGTCACTGTCCTCCTGGCCGCCCGCAGGCGCCGCGGA
GGCTACGAATACTCGGACCAGAAGTCGGGAAAGTCAAAGGGGAAGGATGTTAACTTGGCGGAGTTCGCT
GTGGCTGCAGGGGACCAGATGCTTTACAGGAGTGAGGACATCCAGCTAGATTACAAAAACAACATCCTG
AAGGAGAGGGCGGAGCTGGCCCACAGCCCCCTGCCTGCCAAGTACATCGACCTAGACAAAGGGTTCCGG
AAGGAGAACTGCAAATAG

Restriction Sites SgfI-XhoI     
ACCN NM_001282582
Insert Size 1329 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282582.1
RefSeq Size 2312 bp
RefSeq ORF 1329 bp
Locus ID 54587
UniProt ID Q9BRK3
Protein Families Transmembrane
MW 49.1 kDa
Gene Summary Transmembrane protein which can modulate activity of various signaling pathways, probably via binding to integrin ITGAV:ITGB3 (PubMed:22492581, PubMed:23386276). Mediates heterophilic cell-cell interactions in vitro (By similarity). Inhibits osteoclastogenesis downstream of TNFSF11/RANKL and CSF1, where it may function by attenuating signaling via integrin ITGB3 and MAP kinase p38 (By similarity). Plays a role in cartilage formation where it promotes proliferation and maturation of growth plate chondrocytes (By similarity). Stimulates formation of primary cilia in chondrocytes (By similarity). Enhances expression of genes involved in the hedgehog signaling pathway in chondrocytes, including the hedgehog signaling molecule IHH; may also promote signaling via the PTHLH/PTHrP pathway (By similarity). Plays a role in angiogenesis where it suppresses migration of endothelial cells and also promotes their apoptosis (PubMed:23386276). Inhibits VEGF-induced activation of AKT and p38 MAP kinase in endothelial cells (PubMed:23386276). Also inhibits VTN (vitronectin)-mediated integrin ITGAV:ITGB3 signaling and activation of PTK2/FAK (PubMed:23386276). May play a role in the maturation and maintenance of the blood-brain barrier (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) differs in both UTRs and uses an alternate splice site in the 3' terminal exon compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus compared to isoform 1. Variants 2 and 5 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...