KCNS3 (NM_001282428) Human Untagged Clone

CAT#: SC336427

KCNS3 (untagged) - Human potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 (KCNS3), transcript variant 2



  "NM_001282428" in other vectors (2)

CNY 4660.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
KCNS3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KV9.3
Vector pCMV6-Entry
Sequence Data
>SC336427 representing NM_001282428.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGTTTGGTGAGTTTTTCCATCGCCCTGGACAAGACGAGGAACTTGTCAACCTGAATGTGGGGGGC
TTTAAGCAGTCTGTTGACCAAAGCACCCTCCTGCGGTTTCCTCACACCAGACTGGGGAAGCTGCTTACT
TGCCATTCTGAAGAGGCCATTCTGGAGCTGTGTGATGATTACAGTGTGGCCGATAAGGAATACTACTTT
GATCGGAATCCCTCCTTGTTCAGATATGTTTTGAATTTTTATTACACGGGGAAGCTGCATGTCATGGAG
GAGCTGTGCGTATTCTCATTCTGCCAGGAGATCGAGTACTGGGGCATCAACGAGCTCTTCATTGATTCT
TGCTGCAGCAATCGCTACCAGGAACGCAAGGAGGAAAACCACGAGAAGGACTGGGACCAGAAAAGCCAT
GATGTGAGTACCGACTCCTCGTTTGAAGAGTCGTCTCTGTTTGAGAAAGAGCTGGAGAAGTTTGACACA
CTGCGATTTGGTCAGCTCCGGAAGAAAATCTGGATTAGAATGGAGAATCCAGCGTACTGCCTGTCCGCT
AAGCTTATCGCTATCTCCTCCTTGAGCGTGGTGCTGGCCTCCATCGTGGCCATGTGCGTTCACAGCATG
TCGGAGTTCCAGAATGAGGATGGAGAAGTGGATGATCCGGTGCTGGAAGGAGTGGAGATCGCGTGCATT
GCCTGGTTCACCGGGGAGCTTGCCGTCCGGCTGGCTGCCGCTCCTTGTCAAAAGAAATTCTGGAAAAAC
CCTCTGAACATCATTGACTTTGTCTCTATTATTCCCTTCTATGCCACGTTGGCTGTAGACACCAAGGAG
GAAGAGAGTGAGGATATTGAGAACATGGGCAAGGTGGTCCAGATCCTACGGCTTATGAGGATTTTCCGA
ATTCTAAAGCTTGCCCGGCACTCGGTAGGACTTCGGTCTCTAGGTGCCACACTGAGACACAGCTACCAT
GAAGTTGGGCTTCTGCTTCTCTTCCTCTCTGTGGGCATTTCCATTTTCTCTGTGCTTATCTACTCCGTG
GAGAAAGATGACCACACATCCAGCCTCACCAGCATCCCCATCTGCTGGTGGTGGGCCACCATCAGCATG
ACAACTGTGGGCTATGGAGACACCCACCCGGTCACCTTGGCGGGAAAGCTCATCGCCAGCACATGCATC
ATCTGTGGCATCTTGGTGGTGGCCCTTCCCATCACCATCATCTTCAACAAGTTTTCCAAGTACTACCAG
AAGCAAAAGGACATTGATGTGGACCAGTGCAGTGAGGATGCACCAGAGAAGTGTCATGAGCTACCTTAC
TTTAACATTAGGGATATATATGCACAGCGGATGCACACCTTCATTACCAGTCTCTCTTCTGTAGGCATT
GTGGTGAGCGATCCTGACTCCACAGATGCTTCAAGCATTGAAGACAATGAGGACATTTGTAACACCACC
TCCTTGGAGAATTGCACAGCAAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001282428
Insert Size 1476 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282428.1
RefSeq Size 2415 bp
RefSeq ORF 1476 bp
Locus ID 3790
UniProt ID Q9BQ31
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
MW 56 kDa
Gene Summary Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) has an alternate 5' terminal exon, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...