Human ADAR1 (ADAR) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ADAR
Locus ID	103
Kit Components	GA100067G1, ADAR1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGGGCCATTCAAAGACTAC GA100067G2, ADAR1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGTTCTTCCTCCCACGCC GA100067G3, ADAR1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCTGTTTTGGGTACAGTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001025107, NM_001111, NM_001193495, NM_015840, NM_015841, NM_001365046, NM_001365048, NM_001365049, NM_001365045, NM_001365047
Synonyms	ADAR1; AGS6; DRADA; DSH; DSRAD; G1P1; IFI-4; IFI4; K88DSRBP; P136
Summary	This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.