Human RED1 (ADARB1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ADARB1
Locus ID	104
Kit Components	GA100068G1, RED1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGTGTCTGTCGTGGGCAGC GA100068G2, RED1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGTCTCCTCAGCCGCGCT GA100068G3, RED1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAGGGAGGTGCCACAGCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001033049, NM_001112, NM_001145407, NM_001160230, NM_015833, NM_015834, NR_027672, NR_027673, NR_027674, NR_073200, NM_001346687, NM_001346688, NR_144483
Synonyms	ADAR2; ADAR2a; ADAR2a-L1; ADAR2a-L2; ADAR2a-L3; ADAR2b; ADAR2c; ADAR2d; ADAR2g; DRABA2; DRADA2
Summary	This gene encodes the enzyme responsible for pre-mRNA editing of the glutamate receptor subunit B by site-specific deamination of adenosines. Studies in rat found that this enzyme acted on its own pre-mRNA molecules to convert an AA dinucleotide to an AI dinucleotide which resulted in a new splice site. Alternative splicing of this gene results in several transcript variants, some of which have been characterized by the presence or absence of an ALU cassette insert and a short or long C-terminal region. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.