Human AKT1 activation kit by CRISPRa

CAT#: GA100143

AKT1 CRISPRa kit - CRISPR gene activation of human AKT serine/threonine kinase 1



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

推荐一起购买 (3)
AKT1 mouse monoclonal antibody, clone OTI4D6 (formerly 4D6)
    • 100 ul

CNY 1999.00
CNY 2700.00


AKT1 (Myc-DDK-tagged)-Human v-akt murine thymoma viral oncogene homolog 1 (AKT1), transcript variant 1
    • 10 ug

CNY 3656.00
CNY 3990.00


AKT1 mouse monoclonal antibody, clone OTI1B2 (formerly 1B2)
    • 30 ul

CNY 800.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol AKT1
Locus ID 207
Kit Components

GA100143G1, AKT1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGCCAAGAGTGACCTAAA

GA100143G2, AKT1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTTTCAGGCTGCCCCACTC

GA100143G3, AKT1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GATTCGTCCCTGACCTGTCT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001014431, NM_001014432, NM_005163
Synonyms AKT; CWS6; PKB; PKB-ALPHA; PRKBA; RAC; RAC-ALPHA
Summary This gene encodes one of the three members of the human AKT serine-threonine protein kinase family which are often referred to as protein kinase B alpha, beta, and gamma. These highly similar AKT proteins all have an N-terminal pleckstrin homology domain, a serine/threonine-specific kinase domain and a C-terminal regulatory domain. These proteins are phosphorylated by phosphoinositide 3-kinase (PI3K). AKT/PI3K forms a key component of many signalling pathways that involve the binding of membrane-bound ligands such as receptor tyrosine kinases, G-protein coupled receptors, and integrin-linked kinase. These AKT proteins therefore regulate a wide variety of cellular functions including cell proliferation, survival, metabolism, and angiogenesis in both normal and malignant cells. AKT proteins are recruited to the cell membrane by phosphatidylinositol 3,4,5-trisphosphate (PIP3) after phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2) by PI3K. Subsequent phosphorylation of both threonine residue 308 and serine residue 473 is required for full activation of the AKT1 protein encoded by this gene. Phosphorylation of additional residues also occurs, for example, in response to insulin growth factor-1 and epidermal growth factor. Protein phosphatases act as negative regulators of AKT proteins by dephosphorylating AKT or PIP3. The PI3K/AKT signalling pathway is crucial for tumor cell survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating AKT1 which then phosphorylates and inactivates components of the apoptotic machinery. AKT proteins also participate in the mammalian target of rapamycin (mTOR) signalling pathway which controls the assembly of the eukaryotic translation initiation factor 4F (eIF4E) complex and this pathway, in addition to responding to extracellular signals from growth factors and cytokines, is disregulated in many cancers. Mutations in this gene are associated with multiple types of cancer and excessive tissue growth including Proteus syndrome and Cowden syndrome 6, and breast, colorectal, and ovarian cancers. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2020]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...