Human AKT1 activation kit by CRISPRa
CAT#: GA100143
AKT1 CRISPRa kit - CRISPR gene activation of human AKT serine/threonine kinase 1
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 3656.00
CNY 3990.00
CNY 800.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | AKT1 |
| Locus ID | 207 |
| Kit Components | GA100143G1, AKT1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGCCAAGAGTGACCTAAA GA100143G2, AKT1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTTTCAGGCTGCCCCACTC GA100143G3, AKT1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GATTCGTCCCTGACCTGTCT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001014431, NM_001014432, NM_005163 |
| Synonyms | AKT; CWS6; PKB; PKB-ALPHA; PRKBA; RAC; RAC-ALPHA |
| Summary | This gene encodes one of the three members of the human AKT serine-threonine protein kinase family which are often referred to as protein kinase B alpha, beta, and gamma. These highly similar AKT proteins all have an N-terminal pleckstrin homology domain, a serine/threonine-specific kinase domain and a C-terminal regulatory domain. These proteins are phosphorylated by phosphoinositide 3-kinase (PI3K). AKT/PI3K forms a key component of many signalling pathways that involve the binding of membrane-bound ligands such as receptor tyrosine kinases, G-protein coupled receptors, and integrin-linked kinase. These AKT proteins therefore regulate a wide variety of cellular functions including cell proliferation, survival, metabolism, and angiogenesis in both normal and malignant cells. AKT proteins are recruited to the cell membrane by phosphatidylinositol 3,4,5-trisphosphate (PIP3) after phosphorylation of phosphatidylinositol 4,5-bisphosphate (PIP2) by PI3K. Subsequent phosphorylation of both threonine residue 308 and serine residue 473 is required for full activation of the AKT1 protein encoded by this gene. Phosphorylation of additional residues also occurs, for example, in response to insulin growth factor-1 and epidermal growth factor. Protein phosphatases act as negative regulators of AKT proteins by dephosphorylating AKT or PIP3. The PI3K/AKT signalling pathway is crucial for tumor cell survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating AKT1 which then phosphorylates and inactivates components of the apoptotic machinery. AKT proteins also participate in the mammalian target of rapamycin (mTOR) signalling pathway which controls the assembly of the eukaryotic translation initiation factor 4F (eIF4E) complex and this pathway, in addition to responding to extracellular signals from growth factors and cytokines, is disregulated in many cancers. Mutations in this gene are associated with multiple types of cancer and excessive tissue growth including Proteus syndrome and Cowden syndrome 6, and breast, colorectal, and ovarian cancers. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2020] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN201850 | AKT1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN201850BN | AKT1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN201850LP | AKT1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN201850RB | AKT1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN401850 | AKT1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
