Human CD5 activation kit by CRISPRa
CAT#: GA100648
CD5 CRISPRa kit - CRISPR gene activation of human CD5 molecule
CNY 12255.00
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | CD5 |
| Locus ID | 921 |
| Kit Components | GA100648G1, CD5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAACCGGGGAGTGTCTAAGT GA100648G2, CD5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTGTCTAAGTGGGTCTAA GA100648G3, CD5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAATCGGGCATAAGACAAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_014207, NM_001346456 |
| Synonyms | LEU1; T1 |
| Summary | This gene encodes a member of the scavenger receptor cysteine-rich (SRCR) superfamily. Members of this family are secreted or membrane-anchored proteins mainly found in cells associated with the immune system. This protein is a type-I transmembrane glycoprotein found on the surface of thymocytes, T lymphocytes and a subset of B lymphocytes. The encoded protein contains three SRCR domains and may act as a receptor to regulate T-cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2016] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN206494 | CD5 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN206494BN | CD5 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN206494LP | CD5 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN206494RB | CD5 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN406494 | CD5 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
