Human CD20 (MS4A1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MS4A1
Locus ID	931
Kit Components	GA100658G1, CD20 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCAGTAGCTTCTGCTACCT GA100658G2, CD20 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTGCACCTCCTTCAGCTA GA100658G3, CD20 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGCCCCCACCCTATAAGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_021950, NM_152866, NM_152867
Synonyms	B1; Bp35; CD20; CVID5; LEU-16; MS4A2; S7
Summary	This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This gene encodes a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. This family member is localized to 11q12, among a cluster of family members. Alternative splicing of this gene results in two transcript variants which encode the same protein. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.