Human B7-1 (CD80) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD80
Locus ID	941
Kit Components	GA100663G1, B7-1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAACACCACGAGCACCAGG GA100663G2, B7-1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTGTTAGTCCATGCACGG GA100663G3, B7-1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGTCCATGCACGGTGGTGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_005191
Synonyms	B7; B7-1; B7.1; BB1; CD28LG; CD28LG1; LAB7
Summary	The protein encoded by this gene is a membrane receptor that is activated by the binding of CD28 or CTLA-4. The activated protein induces T-cell proliferation and cytokine production. This protein can act as a receptor for adenovirus subgroup B and may play a role in lupus neuropathy. [provided by RefSeq, Aug 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.