Human B7-2 (CD86) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD86
Locus ID	942
Kit Components	GA100664G1, B7-2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCTCCACACTTTGGTTG GA100664G2, B7-2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGTTTAAACTCATTGACGT GA100664G3, B7-2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAGATTTTGACCACACTTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001206924, NM_001206925, NM_006889, NM_175862, NM_176892
Synonyms	B7-2; B7.2; B70; CD28LG2; LAB72
Summary	This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.[provided by RefSeq, May 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.