Human GCSF Receptor (CSF3R) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CSF3R
Locus ID	1441
Kit Components	GA101015G1, GCSF Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGACGTCTTGGTGAGGCAC GA101015G2, GCSF Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCACAGAATACGTAATGAAG GA101015G3, GCSF Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTACACAATTCCCTGGAACC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000760, NM_156038, NM_156039, NM_172313
Synonyms	CD114; GCSFR
Summary	The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.