Human eIF1A (EIF1AX) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	EIF1AX
Locus ID	1964
Kit Components	GA101361G1, eIF1A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGTCTCCCGGTTTCACAAG GA101361G2, eIF1A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCCCACAACGCGTCTCCCT GA101361G3, eIF1A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCTAACAATAGGAGTCAGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001412
Synonyms	eIF-1A; eIF-4C; EIF1A; EIF1AP1; EIF4C
Summary	This gene encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5' end of capped RNA. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.