Human Thrombin Receptor (F2R) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	F2R
Locus ID	2149
Kit Components	GA101496G1, Thrombin Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACGTCTCCACATCCCAGG GA101496G2, Thrombin Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCGAATCAACGGTGCCCAG GA101496G3, Thrombin Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTCTCACTGCACGCCGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001311313, NM_001992, N35000
Synonyms	CF2R; HTR; PAR-1; PAR1; TR
Summary	Coagulation factor II receptor is a 7-transmembrane receptor involved in the regulation of thrombotic response. Proteolytic cleavage leads to the activation of the receptor. F2R is a G-protein coupled receptor family member. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.