Human Factor VIII (F8) activation kit by CRISPRa
CAT#: GA101502
F8 CRISPRa kit - CRISPR gene activation of human coagulation factor VIII
CNY 12255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | F8 |
Locus ID | 2157 |
Kit Components | GA101502G1, Factor VIII gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTTGGAGTAGGCTAGGAAT GA101502G2, Factor VIII gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATCAGTGGGAAGCAGCCAC GA101502G3, Factor VIII gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTCCCACTGATAAAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_000132, NM_019863 |
Synonyms | AHF; DXS1253E; F8B; F8C; FVIII; HEMA |
Summary | This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN419116 | F8 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |