Human GEM activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	GEM
Locus ID	2669
Kit Components	GA101781G1, GEM gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAAAGCACTTGCGAGCTGT GA101781G2, GEM gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCGGAGTTGCAGCCACT GA101781G3, GEM gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACGTCACGGAAAAGCCCCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_005261, NM_181702
Synonyms	KIR
Summary	The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.