Human HLA DM (HLA-DMA) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	HLA-DMA
Locus ID	3108
Kit Components	GA102120G1, HLA DM gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAGACTTGGCTGTTTGACC GA102120G2, HLA DM gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCACCTATTGGAAATGATC GA102120G3, HLA DM gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GATCTAAGGCCACCCTCTCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_006120
Synonyms	D6S222E; DMA; HLADM; RING6
Summary	HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.