Human HNF 4 alpha (HNF4A) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	HNF4A
Locus ID	3172
Kit Components	GA102164G1, HNF 4 alpha gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCACTTAGGGAACCCGCGGC GA102164G2, HNF 4 alpha gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTCCATGGCAATGGCGACC GA102164G3, HNF 4 alpha gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCCGAGTGGACCTCAGGTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000457, NM_001030003, NM_001030004, NM_001258355, NM_001287182, NM_001287183, NM_001287184, NM_175914, NM_178849, NM_178850
Synonyms	FRTS4; HNF4; HNF4a7; HNF4a8; HNF4a9; HNF4alpha; MODY; MODY1; NR2A1; NR2A21; TCF; TCF14
Summary	The protein encoded by this gene is a nuclear transcription factor which binds DNA as a homodimer. The encoded protein controls the expression of several genes, including hepatocyte nuclear factor 1 alpha, a transcription factor which regulates the expression of several hepatic genes. This gene may play a role in development of the liver, kidney, and intestines. Mutations in this gene have been associated with monogenic autosomal dominant non-insulin-dependent diabetes mellitus type I. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Apr 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.