Human IL2 activation kit by CRISPRa
CAT#: GA102376
IL2 CRISPRa kit - CRISPR gene activation of human interleukin 2
CNY 12255.00
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | IL2 |
Locus ID | 3558 |
Kit Components | GA102376G1, IL2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATGCAATTAGCTCATTGTG GA102376G2, IL2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTCCTCCTTTCTTTAAGG GA102376G3, IL2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACATGTGAATAGCATATTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_000586 |
Synonyms | IL-2; lymphokine; TCGF |
Summary | This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Sep 2020] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN410013 | IL2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |