Human IL2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	IL2
Locus ID	3558
Kit Components	GA102376G1, IL2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATGCAATTAGCTCATTGTG GA102376G2, IL2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTCCTCCTTTCTTTAAGG GA102376G3, IL2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACATGTGAATAGCATATTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000586
Synonyms	IL-2; lymphokine; TCGF
Summary	This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Sep 2020]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.