Human IL12A activation kit by CRISPRa
CAT#: GA102401
IL12A CRISPRa kit - CRISPR gene activation of human interleukin 12A
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 3600.00
CNY 3705.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | IL12A |
| Locus ID | 3592 |
| Kit Components | GA102401G1, IL12A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTTACTGCGCGGGGTCCAC GA102401G2, IL12A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACTTTGCATGTCCTGCGT GA102401G3, IL12A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGCTTAGACACGGGGCGTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_000882, NM_001354582, NM_001354583 |
| Synonyms | CLMF; IL-12A; NFSK; NKSF1; P35 |
| Summary | This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN411224 | IL12A - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |

