Human Insulin (INS) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	INS
Locus ID	3630
Kit Components	GA102433G1, Insulin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGCACCAGGGAAATGGTC GA102433G2, Insulin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTTGAGAGGTAGGGGAGA GA102433G3, Insulin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCGTCAGCACCTCTTCCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000207, NM_001185097, NM_001185098, NM_001291897
Synonyms	IDDM; IDDM1; IDDM2; ILPR; IRDN; MODY10
Summary	This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified, including insulin-dependent diabetes mellitus, permanent neonatal diabetes diabetes mellitus, maturity-onset diabetes of the young type 10 and hyperproinsulinemia. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. [provided by RefSeq, May 2020]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.