Human PDX1 activation kit by CRISPRa
CAT#: GA102446
PDX1 CRISPRa kit - CRISPR gene activation of human pancreatic and duodenal homeobox 1
CNY 12255.00
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | PDX1 |
Locus ID | 3651 |
Kit Components | GA102446G1, PDX1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGGCCGCACTAAGAGGCT GA102446G2, PDX1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCAGGAGTGTGCAGCAAA GA102446G3, PDX1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAACAAAAGCAGGTGCTCGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_000209, NM_013311 |
Synonyms | GSF; IDX-1; IPF1; IUF1; MODY4; PAGEN1; PDX-1; STF-1 |
Summary | The protein encoded by this gene is a transcriptional activator of several genes, including insulin, somatostatin, glucokinase, islet amyloid polypeptide, and glucose transporter type 2. The encoded nuclear protein is involved in the early development of the pancreas and plays a major role in glucose-dependent regulation of insulin gene expression. Defects in this gene are a cause of pancreatic agenesis, which can lead to early-onset insulin-dependent diabetes mellitus (IDDM), as well as maturity onset diabetes of the young type 4 (MODY4). [provided by RefSeq, Aug 2017] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN422354 | PDX1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |