Human Kallikrein 2 (KLK2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	KLK2
Locus ID	3817
Kit Components	GA102587G1, Kallikrein 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAATCTGACCTCACACCGT GA102587G2, Kallikrein 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACATACTAGATCAGTCTGG GA102587G3, Kallikrein 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCAGCATCTAGGTGCCAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001002231, NM_001002232, NM_001256080, NM_005551, NR_045762, NR_045763
Synonyms	hGK-1; hK2; KLK2A2
Summary	This gene encodes a member of the grandular kallikrein protein family. Kallikreins are a subgroup of serine proteases that are clustered on chromosome 19. Members of this family are involved in a diverse array of biological functions. The protein encoded by this gene is a highly active trypsin-like serine protease that selectively cleaves at arginine residues. This protein is primarily expressed in prostatic tissue and is responsible for cleaving pro-prostate-specific antigen into its enzymatically active form. This gene is highly expressed in prostate tumor cells and may be a prognostic maker for prostate cancer risk. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Jan 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.