Human Leptin (LEP) activation kit by CRISPRa
CAT#: GA102677
LEP CRISPRa kit - CRISPR gene activation of human leptin
CNY 12255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | LEP |
Locus ID | 3952 |
Kit Components | GA102677G1, Leptin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGCCACGCGCGCACCCT GA102677G2, Leptin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATAGTCGCGCCGGAGCCTC GA102677G3, Leptin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACGTCGCTACCCTGAGGGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_000230 |
Synonyms | LEPD; OB; OBS |
Summary | This gene encodes a protein that is secreted by white adipocytes into the circulation and plays a major role in the regulation of energy homeostasis. Circulating leptin binds to the leptin receptor in the brain, which activates downstream signaling pathways that inhibit feeding and promote energy expenditure. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis, reproduction, bone formation and wound healing. Mutations in this gene and its regulatory regions cause severe obesity and morbid obesity with hypogonadism in human patients. A mutation in this gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Aug 2017] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN409259 | LEP - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |