Human MECP2 activation kit by CRISPRa
CAT#: GA102863
MECP2 CRISPRa kit - CRISPR gene activation of human methyl-CpG binding protein 2
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 3656.00
CNY 3990.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | MECP2 |
| Locus ID | 4204 |
| Kit Components | GA102863G1, MECP2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAGGATTAATGGACCCTTG GA102863G2, MECP2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGGAAATCTCGCCAATTGA GA102863G3, MECP2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATCACAGCCAATGACGGGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_001110792, NM_001316337, NM_004992, NM_001369391, NM_001369394, NM_001369392, NM_001369393 |
| Synonyms | AUTSX3; MRX16; MRX79; MRXS13; MRXSL; PPMX; RS; RTS; RTT |
| Summary | DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN202382 | MECP2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN202382BN | MECP2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN202382LP | MECP2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN202382RB | MECP2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN402382 | MECP2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
