Human c-Myc (MYC) activation kit by CRISPRa

CAT#: GA103055

MYC CRISPRa kit - CRISPR gene activation of human MYC proto-oncogene, bHLH transcription factor



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

推荐一起购买 (3)
c-Myc (c-Myc ) mouse monoclonal antibody, clone OTI1A6 (formerly 1A6)
    • 100 ul

CNY 1999.00
CNY 2700.00


MYC (Myc-DDK-tagged)-Human v-myc myelocytomatosis viral oncogene homolog (avian) (Myc)
    • 10 ug

CNY 5488.00


MYC biotinylated mouse monoclonal detection antibody, validated for ELISA and Luminex assays
    • 50 ug

CNY 2700.00
CNY 3790.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol MYC
Locus ID 4609
Kit Components

GA103055G1, c-Myc gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTATGTATGCACAGCTATC

GA103055G2, c-Myc gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTTGGCAGCAAATTG

GA103055G3, c-Myc gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAATTGGGGGACTCAGTCT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_002467, NM_001354870
Synonyms bHLHe39; c-Myc; MRTL; MYCC
Summary This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. The encoded protein forms a heterodimer with the related transcription factor MAX. This complex binds to the E box DNA consensus sequence and regulates the transcription of specific target genes. Amplification of this gene is frequently observed in numerous human cancers. Translocations involving this gene are associated with Burkitt lymphoma and multiple myeloma in human patients. There is evidence to show that translation initiates both from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site, resulting in the production of two isoforms with distinct N-termini. [provided by RefSeq, Aug 2017]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...