Human PD1 (PDCD1) activation kit by CRISPRa
CAT#: GA103431
PDCD1 CRISPRa kit - CRISPR gene activation of human programmed cell death 1
CNY 12255.00
CNY 1999.00
CNY 2700.00
CNY 3600.00
CNY 3990.00
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | PDCD1 |
| Locus ID | 5133 |
| Kit Components | GA103431G1, PD1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAGGTCAGGTTGAAGGGA GA103431G2, PD1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGAGTGACAGAGGCAGTGC GA103431G3, PD1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGAGGAGGGGGTAGGACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_005018 |
| Synonyms | CD279; hPD-1; hPD-l; hSLE1; PD-1; PD1; SLEB2 |
| Summary | Programmed cell death protein 1 (PDCD1) is an immune-inhibitory receptor expressed in activated T cells; it is involved in the regulation of T-cell functions, including those of effector CD8+ T cells. In addition, this protein can also promote the differentiation of CD4+ T cells into T regulatory cells. PDCD1 is expressed in many types of tumors including melanomas, and has demonstrated to play a role in anti-tumor immunity. Moreover, this protein has been shown to be involved in safeguarding against autoimmunity, however, it can also contribute to the inhibition of effective anti-tumor and anti-microbial immunity. [provided by RefSeq, Aug 2020] |
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN210364 | PDCD1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN210364BN | PDCD1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN210364LP | PDCD1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN210364RB | PDCD1 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12260.00 |
|
| KN410364 | PDCD1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
