Human Polycystin 1 (PKD1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PKD1
Locus ID	5310
Kit Components	GA103572G1, Polycystin 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCGATGAGGGACTGGCATC GA103572G2, Polycystin 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACCCTCCGCTCCACAGGGT GA103572G3, Polycystin 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCCCGTCGCACTGTAGAGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000296, NM_001009944
Synonyms	PBP; Pc-1; TRPP1
Summary	This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.