Human Exodus 2 (CCL21) activation kit by CRISPRa
CAT#: GA104328
CCL21 CRISPRa kit - CRISPR gene activation of human C-C motif chemokine ligand 21
CNY 12255.00
Cited in 1 publication. |
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | CCL21 |
Locus ID | 6366 |
Kit Components | GA104328G1, Exodus 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCCAGGGGAGAGGCAGTG GA104328G2, Exodus 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGTCTCCTCACTACGCTCC GA104328G3, Exodus 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTAACTCTGTCACCCAGGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_002989 |
Synonyms | 6Ckine; CKb9; ECL; SCYA21; SLC; TCA4 |
Summary | This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). [provided by RefSeq, Sep 2014] |
Citations (1)
The use of this Gene Expression has been cited in the following citations: |
---|
Mumps virus infection disrupts blood-testis barrier through the induction of TNF-α in Sertoli cells
,null,
The FASEB Journal
,PubMed ID 31450968
[CCL21]
|
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN406579 | CCL21 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |