Human Exodus 2 (CCL21) activation kit by CRISPRa

CAT#: GA104328

CCL21 CRISPRa kit - CRISPR gene activation of human C-C motif chemokine ligand 21



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Cited in 1 publication.

Product images

推荐一起购买 (3)
Rabbit Polyclonal Anti-CCL21 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


CCL21 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 21 (CCL21)
    • 10 ug

CNY 1200.00
CNY 3705.00


CCL21 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol CCL21
Locus ID 6366
Kit Components

GA104328G1, Exodus 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTCCAGGGGAGAGGCAGTG

GA104328G2, Exodus 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGTCTCCTCACTACGCTCC

GA104328G3, Exodus 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTAACTCTGTCACCCAGGC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_002989
Synonyms 6Ckine; CKb9; ECL; SCYA21; SLC; TCA4
Summary This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). [provided by RefSeq, Sep 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Other Versions

Customer Reviews 
Loading...