Human SRD5A1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SRD5A1
Locus ID	6715
Kit Components	GA104614G1, SRD5A1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAGGCTTCTCCGGGGTAGC GA104614G2, SRD5A1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGAGCCCGCGTGGGAAACC GA104614G3, SRD5A1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTTACTGCGGCCCCGGCGT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001047, NM_001324322, NM_001324323, NR_136739
Synonyms	S5AR 1
Summary	Steroid 5-alpha-reductase (EC 1.3.99.5) catalyzes the conversion of testosterone into the more potent androgen, dihydrotestosterone (DHT). Also see SRD5A2 (MIM 607306).[supplied by OMIM, Mar 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.