Human Thyroid Peroxidase (TPO) activation kit by CRISPRa
CAT#: GA104957
TPO CRISPRa kit - CRISPR gene activation of human thyroid peroxidase
CNY 12255.00
| Cited in 5 publications. |
Specifications
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
| Symbol | TPO |
| Locus ID | 7173 |
| Kit Components | GA104957G1, Thyroid Peroxidase gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTGGCGTCCGTTCTTCGT GA104957G2, Thyroid Peroxidase gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCACATGCAGTCCAGCCTC GA104957G3, Thyroid Peroxidase gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCATGTGGACCCCGATGACA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| Reference Data | |
| RefSeq | NM_000547, NM_001206744, NM_001206745, NM_175719, NM_175720, NM_175721, NM_175722 |
| Synonyms | MSA; TDH2A; TPX |
| Summary | This gene encodes a membrane-bound glycoprotein. The encoded protein acts as an enzyme and plays a central role in thyroid gland function. The protein functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mutations in this gene are associated with several disorders of thyroid hormonogenesis, including congenital hypothyroidism, congenital goiter, and thyroid hormone organification defect IIA. Multiple transcript variants encoding distinct isoforms have been identified for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2011] |
Citations (5)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
Estrogen administration attenuates post-stroke depression by enhancing CREB/BDNF/TrkB signaling in the rat hippocampus
,null,
Experimental and Therapeutic Medicine
,PubMed ID 33747172
[TPO]
|
|
Clinical characteristics and prognostic significance of TCGA and ACRG classification in gastric cancer among the Chinese population
,null,
Molecular Medicine Reports
,PubMed ID 32468041
[TPO]
|
|
lncRNA-ATB promotes stemness maintenance in colorectal cancer by regulating transcriptional activity of the β-catenin pathway
,null,
Experimental and Therapeutic Medicine
,PubMed ID 32256798
[TPO]
|
|
Clinical Implication and the Hereditary Factors of NM23 in Hepatocellular Carcinoma Based on Bioinformatics Analysis and Genome–Wide Association Study
,null,
Journal of Oncology
,PubMed ID 30662464
[TPO]
|
|
BMP7 regulates lung fibroblast proliferation in newborn rats with bronchopulmonary dysplasia
,null,
Molecular Medicine Reports
,PubMed ID 29512787
[TPO]
|
Documents
Resources
| 基因表达相关资源 |
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| KN410659 | TPO - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8680.00 |
