Human MALL activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MALL
Locus ID	7851
Kit Components	GA105336G1, MALL gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAGATGGTGGACATGGCTG GA105336G2, MALL gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCACATCCTAGAGAGGGAC GA105336G3, MALL gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGCAGGGAGACAAACAAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_005434
Synonyms	BENE
Summary	This gene encodes an element of the machinery for raft-mediated trafficking in endothelial cells. The encoded protein, a member of the MAL proteolipid family, predominantly localizes in glycolipid- and cholesterol-enriched membrane (GEM) rafts. It interacts with caveolin-1. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.