Human ST8SIA4 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ST8SIA4
Locus ID	7903
Kit Components	GA105350G1, ST8SIA4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGACTATCTTGGAGCTCCC GA105350G2, ST8SIA4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCTTGGAGAGTAACGTCCC GA105350G3, ST8SIA4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCGCAAAGCCAATCACC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_005668, NM_175052
Synonyms	PST; PST1; SIAT8D; ST8SIA-IV
Summary	The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.