Human GPR65 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	GPR65
Locus ID	8477
Kit Components	GA105601G1, GPR65 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGGGAGATGTATACGAA GA105601G2, GPR65 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGAGATGCTGCTTCCTCAT GA105601G3, GPR65 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACATATATTCCATTAAGTAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_003608
Synonyms	hTDAG8; TDAG8
Summary	Receptor for the glycosphingolipid psychosine (PSY) and several related glycosphingolipids (PubMed:11309421). Plays a role in immune response by maintaining lysosome function and supporting phagocytosis-mediated intracellular bacteria clearance (PubMed:27287411). May have a role in activation-induced cell death or differentiation of T-cells (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.