Human Securin (PTTG1) activation kit by CRISPRa

CAT#: GA106157

PTTG1 CRISPRa kit - CRISPR gene activation of human PTTG1 regulator of sister chromatid separation, securin



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

推荐一起购买 (3)
Anti-PTTG1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


PTTG1 (Myc-DDK-tagged)-Human pituitary tumor-transforming 1 (PTTG1)
    • 10 ug

CNY 3600.00
CNY 3705.00


Securin Rabbit monoclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol PTTG1
Locus ID 9232
Kit Components

GA106157G1, Securin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTAGGTCCTTTCCAT

GA106157G2, Securin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTACTTGGTGACCACGCCCA

GA106157G3, Securin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACCACAACTCGCGGCCCAAT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_001282382, NM_001282383, NM_004219
Synonyms EAP1; HPTTG; PTTG; TUTR1
Summary The encoded protein is a homolog of yeast securin proteins, which prevent separins from promoting sister chromatid separation. It is an anaphase-promoting complex (APC) substrate that associates with a separin until activation of the APC. The gene product has transforming activity in vitro and tumorigenic activity in vivo, and the gene is highly expressed in various tumors. The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression. It also contains a destruction box (D box) that is required for its degradation by the APC. The acidic C-terminal region of the encoded protein can act as a transactivation domain. The gene product is mainly a cytosolic protein, although it partially localizes in the nucleus. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...