Human CD83 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD83
Locus ID	9308
Kit Components	GA106201G1, CD83 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAATAGGAGACACTCTCCTT GA106201G2, CD83 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACTGACTGATAACCTCCCG GA106201G3, CD83 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACATACAAGTCTGTAGTACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001040280, NM_001251901, NM_004233
Synonyms	BL11; HB15
Summary	The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.