Human GPRASP1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	GPRASP1
Locus ID	9737
Kit Components	GA106545G1, GPRASP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACGCCTCTGCACCAAACT GA106545G2, GPRASP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGATACGGCGCGAAAGTGC GA106545G3, GPRASP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACCTCTGGGTCGGAACTA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001099410, NM_001099411, NM_001184727, NM_014710
Synonyms	GASP; GASP-1; GASP1
Summary	This gene encodes a member of the GPRASP (G protein-coupled receptor associated sorting protein) family. The protein may modulate lysosomal sorting and functional down-regulation of a variety of G-protein coupled receptors. It targets receptors for degradation in lysosomes. The receptors interacting with this sorting protein include D2 dopamine receptor (DRD2), delta opioid receptor (OPRD1), beta-2 adrenergic receptor (ADRB2), D4 dopamine receptor (DRD4) and cannabinoid 1 receptor (CB1R). Multiple alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, May 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.