Human IGF2BP1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	IGF2BP1
Locus ID	10642
Kit Components	GA107292G1, IGF2BP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGTCCCCAGGTCAGACCCG GA107292G2, IGF2BP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCACCACCCGGGACACTGC GA107292G3, IGF2BP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGACCATTCAAATCTCCACC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001160423, NM_006546
Synonyms	CRD-BP; CRDBP; IMP-1; IMP1; VICKZ1; ZBP1
Summary	This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.