Human SMG1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SMG1
Locus ID	23049
Kit Components	GA107999G1, SMG1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAATCAAGGACCTGCGGTGT GA107999G2, SMG1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGGTGACGAATCCTAAGACA GA107999G3, SMG1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGACCTCTTCGCCGCCCAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_014006, NM_015092
Synonyms	61E3.4; ATX; KIAA0421; LIP
Summary	This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.