Human DNMT3L activation kit by CRISPRa

CAT#: GA109332

DNMT3L CRISPRa kit - CRISPR gene activation of human DNA methyltransferase 3 like



  See Other Versions

CNY 12255.00


货期*
4周

规格
    • 1 kit

Product images

推荐一起购买 (3)
Anti-DNMT3L Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


DNMT3L (Myc-DDK-tagged)-Human DNA (cytosine-5-)-methyltransferase 3-like (DNMT3L), transcript variant 1
    • 10 ug

CNY 3656.00
CNY 5320.00


DNMT3L Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol DNMT3L
Locus ID 29947
Kit Components

GA109332G1, DNMT3L gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGCCCCTCCCACTGCAAAC

GA109332G2, DNMT3L gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCCAGAGGTCACCAGGCTA

GA109332G3, DNMT3L gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCTATGGGGGCAAAGAATC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_013369, NM_175867
Synonyms MGC1090
Summary CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein with similarity to DNA methyltransferases, but is not thought to function as a DNA methyltransferase as it does not contain the amino acid residues necessary for methyltransferase activity. However, it does stimulate de novo methylation by DNA cytosine methyltransferase 3 alpha and is thought to be required for the establishment of maternal genomic imprints. This protein also mediates transcriptional repression through interaction with histone deacetylase 1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...