Human PLAC8 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PLAC8
Locus ID	51316
Kit Components	GA109735G1, PLAC8 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACTGATACGTCTTTTTAAT GA109735G2, PLAC8 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGTGTACCTAACACAATAT GA109735G3, PLAC8 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACTTCTGCTGGATTACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001130715, NM_001130716, NM_016619
Synonyms	C15; DGIC; onzin; PNAS-144

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.