Human HAO1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	HAO1
Locus ID	54363
Kit Components	GA110088G1, HAO1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACCTGTATGAAACCACTCT GA110088G2, HAO1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCCTTCCCAACCTCAACTT GA110088G3, HAO1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATAGTGACTTCGGTGTTCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_017545
Synonyms	GOX; GOX1; HAOX1
Summary	This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.