Human IL17B Receptor (IL17RB) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	IL17RB
Locus ID	55540
Kit Components	GA110783G1, IL17B Receptor gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCTTTTATCCCGGCGCCGC GA110783G2, IL17B Receptor gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGACCTGCCCCAGCCTGGGA GA110783G3, IL17B Receptor gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTGTTCGGGTGGCGGGAAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_018725, NM_172234
Synonyms	CRL4; EVI27; IL17BR; IL17RH1
Summary	The protein encoded by this gene is a cytokine receptor. This receptor specifically binds to IL17B and IL17E, but does not bind to IL17 and IL17C. This receptor has been shown to mediate the activation of NF-kappaB and the production of IL8 induced by IL17E. The expression of the rat counterpart of this gene was found to be significantly up-regulated during intestinal inflammation, which suggested the immunoregulatory activity of this receptor. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.