Human NLRX1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	NLRX1
Locus ID	79671
Kit Components	GA112536G1, NLRX1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACACTCATGCTTGCATACGA GA112536G2, NLRX1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGGGTCTGACACCCATTCA GA112536G3, NLRX1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCACCCCAACCTGCTCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001282143, NM_001282144, NM_001282358, NM_024618, NM_170722
Synonyms	CLR11.3; DLNB26; NOD5; NOD9; NOD26
Summary	The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2013]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.