Human Josephin 2 (JOSD2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	JOSD2
Locus ID	126119
Kit Components	GA114916G1, Josephin 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCGACGGAAGTTGTAGTG GA114916G2, Josephin 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCCACGGGAGTCGTAGTC GA114916G3, Josephin 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGGCCCTTCTTTCGCATA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001270639, NM_001270640, NM_001270641, NM_001270686, NM_138334
Synonyms	SBBI54
Summary	This gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.