Human RBM20 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	RBM20
Locus ID	282996
Kit Components	GA116976G1, RBM20 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAAGTAGTTGCTAGGTCTC GA116976G2, RBM20 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTTTCCTCCCGCAACCACG GA116976G3, RBM20 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCTTTTCTCTACTTCCCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001134363
Summary	This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.