Mouse Fgf18 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Fgf18
Locus ID	14172
Kit Components	GA201399G1, Fgf18 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAAGCTGGACTGAAGCGGG GA201399G2, Fgf18 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAGTCCAGCTTCCCCGCAC GA201399G3, Fgf18 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCTGCAGACTCTGCTGCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_008005, NR_102395
Synonyms	D130055P09Rik; FGF-18
Summary	Plays an important role in the regulation of cell proliferation, cell differentiation and cell migration. Required for normal ossification and bone development. Stimulates hepatic and intestinal proliferation (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.