Mouse Fgf18 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Fgf18
Locus ID	14172
Kit Components	GA201399G1, Fgf18 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAAGCTGGACTGAAGCGGG GA201399G2, Fgf18 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAGTCCAGCTTCCCCGCAC GA201399G3, Fgf18 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCTGCAGACTCTGCTGCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_008005, NR_102395
Synonyms	D130055P09Rik; FGF-18
Summary	Plays an important role in the regulation of cell proliferation, cell differentiation and cell migration. Required for normal ossification and bone development. Stimulates hepatic and intestinal proliferation (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.