Mouse H19 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	H19
Locus ID	14955
Kit Components	GA201799G1, H19 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGCACCACCGTTCTATGA GA201799G2, H19 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGACATCAAGGGAGATATC GA201799G3, H19 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGTGCGCTGGAACGATACA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NR_001592, NR_130973, NR_130974

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.