Mouse Il4 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Il4
Locus ID	16189
Kit Components	GA202145G1, Il4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCAGAATAACTGACAATC GA202145G2, Il4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGGGAAAATGAGTTTACAT GA202145G3, Il4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGGAGAAAAAAGAGAAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_021283, NR_027491
Synonyms	BSF-1; Il-4
Summary	Participates in at least several B-cell activation processes as well as of other cell types (PubMed:3083412). It is a costimulator of DNA-synthesis. It induces the expression of class II MHC molecules on resting B-cells (PubMed:3498301). It enhances both secretion and cell surface expression of IgE and IgG1 (PubMed:3498301). It also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Positively regulates IL31RA expression in macrophages (PubMed:25847241). Stimulates autophagy in dendritic cells by interfering with mTORC1 signaling and through the induction of RUFY4 (PubMed:26416964).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.