Mouse Ins1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Ins1
Locus ID	16333
Kit Components	GA202174G1, Ins1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGCTGGGAACTGGTTCATC GA202174G2, Ins1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCTTAATAAGGGACCAGA GA202174G3, Ins1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAACACATCTACTTAGTCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_008386
Synonyms	Ins-1; Ins2-rs1
Summary	This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. The encoded precursor protein undergoes proteolytic cleavage to produce a disulfide-linked heterodimeric functional protein that is stored in secretory granules. An increase in blood glucose levels, among others, induces the release of insulin from the secretory granules. Mice deficient in the functional hormone encoded by this gene develop diabetes mellitus. [provided by RefSeq, Aug 2015]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.